Journal of Combinatorial Optimization 7(4) (2003)ĭ’yachkov, A.G., Macula, A.J., Pogozelski, W.K., Renz, T.E., Rykov, V.V., Torney, D.C.: A weighted insertion–deletion stacked pair thermodynamic metric for DNA codes. of ISIT–2002, Lausanne, Switzerland (July 2002)ĭ’yachkov, A.G., Erdos, P.L., Macula, A.J., Rykov, V.V., Torney, D.C., Tung, C.-S., Vilenkin, P.A., White, P.S.: Exordium for DNA codes. You may want to work with the reverse-complement of a sequence if it contains an ORF on the reverse strand. of 4-th World Multiconference on Systemics, Cybernetics and Informatics, Orlando, Florida, USA (July 2000)ĭ’yachkov, A.G., Torney, D.C., Vilenkin, P.A., White, P.S.: On a class of codes for the insertion-deletion metric. Reverse Complement converts a DNA sequence into its reverse, complement, or reverse-complement counterpart. Rykov, V.V., Macula, A.J., Korzelius, C.M., Engelhart, D.C., Torney, D.C., White, P.S.: DNA sequences constructed on the basis of quaternary cyclic codes. This tool determines the reverse complement of the provided nucleotide sequence. dissertation, Moscow State University (2000) Vilenkin, P.A.: Some asymptotic problems of combinatorial coding theory and information theory (in Russian), Ph.D. of ISIT–2000, Sorrento, Italy (July 2000) The reverse complement is the sequence formed by reversing the original sequence and replacing each nucleotide with its complementary base. Theory 46(4), 1558–1564 (2000)ĭ’yachkov, A.G., Torney, D.C., Vilenkin, P.A., White, P.S.: Reverse–complement similarity codes for DNA sequences. dissertation, University of Warwick (1994)ĭ’yachkov, A.G., Torney, D.C.: On similarity codes. CRC Press, Inc., Boca Raton, Florida (1989)ĭancik, V.: Expected length of longest common subsequences, Ph.D. (ed.): Mathematical Methods for DNA Sequences. Thus, the reverse complement of a DNA sequence is obtained by first reversing the order of the bases and then replacing each base with its complement. North-Holland, Amsterdam, The Netherlands (1977)īreslauer, K.J., Frank, R., Blöcker, H., Marky, L.A.: Predicting DNA duplex stability from the base sequence. MacWilliams, F.J., Sloane, N.J.A.: The Theory of Error-Correcting Codes. McEliece, R.J., Rodemich, E.R., Rumsey Jr., H., Welch, L.R.: New upper bounds on the rate of a code via the Delsarte-MacWilliams inequalities. In: Discrete Mathematics and Mathematical Problems of Cybernetics, Moscow, Nauka, pp. In this 1-hour long project-based course, you will learn the basic building blocks in the Python language and how to Develop a Python program that constructs reverse, complement, and reverse-complement nucleic acid sequences (DNA, RNA). Levenshtein, V.I.: Elements of coding theory (in Russian). This plugin adds two operations to Geneious, one to reverse a DNA sequence (without complementing) and one to complement a DNA sequence (without reversing). Levenshtein, V.I.: Binary codes capable of correcting deletions, insertions, and reversals. See the Tutorial on how to create reverse complement sequence.Massey, J.L.: Reversible codes. The European Union late on Monday reversed an earlier announcement by an EU commissioner that the bloc was immediately suspending aid for Palestinian authorities. Any entered U are automatically converted into T. Uridine (U) is the replacement for Thymidine (T) in RNA. Reverse complement: CTATGGTCATCCATCTCTACGTGTCAGCCTATACGT Reverse sequence: GATACCAGTAGGTAGAGATGCACAGTCGGATATGCAĬomplement sequence: TGCATATCCGACTGTGCATCTCTACCTACTGGTATC Original sequence: ACGTATAGGCTGACACGTAGAGATGGATGACCATAG The reverse complement sequence is the sequence of the lower strand in the direction of its 5′- to its 3′-end. The reverse sequence is the sequence of the upper strand in the direction from its 3′- to its 5′-end. The complementary sequence is thus the sequence of the lower (antisense) strand in the same direction as the upper strand. ![]() This counterpart is called its complementary nucleotide.ĭouble stranded DNA sequences are represented by the upper (sense) strand sequence going in the direction from its 5′- to 3′-end. See also how to create a reverse complement sequence.Įach nucleotide in a double stranded DNA molecule is paired with its Watson-Crick counterpart. ![]() Go to the main site of GeneWarrior What is a Reverse Complement sequence? This page is part of the GeneWarrior Documentation.
0 Comments
Leave a Reply. |
AuthorWrite something about yourself. No need to be fancy, just an overview. ArchivesCategories |